Top » Catalog » J1 » BY10490

$18.00

BY10490
[BY10490]

BY10490
hg38 Position: ChrY:14369849..14369849
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY10490_F GCCTCAGCCTCCTGAGTAAC
Reverse Primer: BY10490_R TGGAGACCGGGAAAATAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
1 x CTS11741
1 x FGC5205
1 x FGC42828
1 x A18933
1 x ALK396
1 x BY74
1 x CTS15
1 x FGC17478
1 x ALK199
1 x A18075
1 x A22248
1 x FGC39467
1 x B238
1 x ALK395
1 x FGC30416
1 x FGC16640
$306.00
Haplogroup Info
Other products
Currencies