Top » Catalog » J1 » BY10490

$18.00

BY10490
[BY10490]

BY10490
hg38 Position: ChrY:14369849..14369849
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY10490_F GCCTCAGCCTCCTGAGTAAC
Reverse Primer: BY10490_R TGGAGACCGGGAAAATAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies