Top » Catalog » J1 » FGC45011

$18.00

FGC45011
[FGC45011]

FGC45011
hg38 Position: ChrY:19296043..19296043
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y20496
Forward Primer: FGC45011_F GTCCCTGGCATGAGACTAGG
Reverse Primer: FGC45011_R CAAGCTCTGCTTTTTGAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies