Top » Catalog » J1 » FGC15760

$18.00

FGC15760
[FGC15760]

FGC15760
hg38 Position: ChrY:15065229..15065229
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC15760_F GACAATATGACTTCCTCTTTTCCTG
Reverse Primer: FGC15760_R GCACATCAAAAAACTTTTCCG
Reviews

Customers who bought this product also purchased
FGC59067
FGC59067
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z640
Z640
FGC60653
FGC60653
FGC15762
FGC15762
FGC59164
FGC59164
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40447
1 x FGC12857
1 x FGC37843
1 x BY32851
1 x ALK161
1 x ALK281
1 x FGC4417
1 x FGC4402
1 x A18931
1 x FGC4339
1 x A16982
1 x FGC40060
$216.00
Haplogroup Info
Other products
Currencies