Top » Catalog » J1 » HU69

$19.00

HU69
[HU69]

HU69
hg38 Position: ChrY:19354502..19354502
Ancestral: G
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream FGC4745
Forward Primer: HU69_F TTGGACTGGGACCTACAAGG
Reverse Primer: HU69_R CCCCAAAGTGGTAGATGCAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies