Top » Catalog » J1 » FGC44917

$18.00

FGC44917
[FGC44917]

FGC44917
hg38 Position: ChrY:2888607..2888607
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y20902
Forward Primer: FGC44917_F ATTGGTGGTCAGATGCTTCC
Reverse Primer: FGC44917_R CTCAGCAAGCCTTTGTTTCC
Reviews

Customers who bought this product also purchased
FGC4290
FGC4290
FGC44938
FGC44938
FGC7
FGC7
FGC1707
FGC1707
L858
L858
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies