Top » Catalog » J1 » FGC44917

$18.00

FGC44917
[FGC44917]

FGC44917
hg38 Position: ChrY:2888607..2888607
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y20902
Forward Primer: FGC44917_F ATTGGTGGTCAGATGCTTCC
Reverse Primer: FGC44917_R CTCAGCAAGCCTTTGTTTCC
Reviews

Customers who bought this product also purchased
FGC4290
FGC4290
FGC1707
FGC1707
L858
L858
FGC44938
FGC44938
FGC7
FGC7
FGC44943
FGC44943
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies