Top » Catalog » J1 » FGC44923

$18.00

FGC44923
[FGC44923]

FGC44923
hg38 Position: ChrY:8854665..8854665
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y21324
Forward Primer: FGC44923_F TGGCAACAACTCTACAAGGTG
Reverse Primer: FGC44923_R AACTGGGCATCTCACAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK281
$18.00
Haplogroup Info
Other products
Currencies