Top » Catalog » J1 » FGC13864

$18.00

FGC13864
[FGC13864]

FGC13864
hg38 Position: ChrY:19125178..19125178
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227
Forward Primer: FGC13864_F GTTTTCTGTGTATCAGGAGACTGTG
Reverse Primer: FGC13864_R CTTTCTTTTCCCTCACATACCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies