Top » Catalog » J1 » HU235

$19.00

HU235
[HU235]

HU235
hg38 Position: ChrY:14679302..14679302
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC11 > FGC3729
Forward Primer: HU235_F GGTTCCAGTGATCCTCTTGC
Reverse Primer: HU235_R AGGGTGGGGTGATTACAGC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies