Top » Catalog » J1 » HU247

$19.00

HU247
[HU247]

HU247
hg38 Position: ChrY:8603326..8603326
Ancestral: G
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC11 > FGC3729
Forward Primer: HU247_F GACTGTGGGATTCCATGCTC
Reverse Primer: HU247_R CCATATCTGACCTTATTGTTACTCATATTC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies