Top » Catalog » J1 » HU249

$19.00

HU249
[HU249]

HU249
hg38 Position: ChrY:12334832..12334832
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below ZS4207
Forward Primer: HU249_F TGCATTTCTTTTGAACATCACC
Reverse Primer: HU249_R GACTTCCTGAGGCTGTGGAG
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
FT178165
FT178165
BY527
BY527
FGC10401
FGC10401
L858
L858
Y85339
Y85339
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies