Top » Catalog » J1 » HU372

$19.00

HU372
[HU372]

HU372
hg38 Position: ChrY:19723388..19723388
Ancestral: C
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC2
Forward Primer: HU372_F GCTGAAGACTGAGGGTGGAC
Reverse Primer: HU372_R CACATTCTGGCGTGCAGTAG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies