Top » Catalog » J1 » FGC17492

$18.00

FGC17492
[FGC17492]

FGC17492
hg38 Position: ChrY:20374726..20374726
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17492_F GAGTAAGGCCTTGTCTCAAACAG
Reverse Primer: FGC17492_R TTTTTATTTTCTTTGCCTTGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies