Top » Catalog » J1 » FGC58500

$18.00

FGC58500
[FGC58500]

FGC58500
hg38 Position: ChrY:20476697..20476697
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58500_F GCCTTAAGCACAATTGAAATACAG
Reverse Primer: FGC58500_R GAAGAGGCATACTTGTGCACTG
Reviews

Customers who bought this product also purchased
FGC58498
FGC58498
FGC58493
FGC58493
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BZ1440
1 x FGC8710
$36.00
Haplogroup Info
Other products
Currencies