Top » Catalog » J1 » FGC8716

$18.00

FGC8716
[FGC8716]

FGC8716
hg38 Position: ChrY:19463147..19463147
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments:
Forward Primer: FGC8716_F TTGGCCTTCTCCATTTTCTG
Reverse Primer: FGC8716_R TGGGGACTGGAGTCATAAGC
Reviews

Customers who bought this product also purchased
FGC8733
FGC8733
FGC8728
FGC8728
FGC8727
FGC8727
FGC8715
FGC8715
FGC8729
FGC8729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15206
1 x CLD74
1 x N1a-VL29 Panel
$124.00
Haplogroup Info
Other products
Currencies