Top » Catalog » J1 » FGC8729

$18.00

FGC8729
[FGC8729]

FGC8729
hg38 Position: ChrY:20932856..20932856
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8729_F TAAAGCATTATGTACATTAAAAATTTTAGTACC
Reverse Primer: FGC8729_R AAGGATATTGGTCTAAAACTCTTGTTTG
Reviews

Customers who bought this product also purchased
FGC8733
FGC8733
FGC8728
FGC8728
FGC8715
FGC8715
FGC8716
FGC8716
FGC8727
FGC8727
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
1 x A19929
1 x BY13788
1 x FGC49261
1 x ALK576
1 x FGC23315
1 x FGC5468
1 x FGC7944
1 x FGC8812
$324.00
Haplogroup Info
Other products
Currencies