Top » Catalog » J1 » FGC8727

$18.00

FGC8727
[FGC8727]

FGC8727
hg38 Position: ChrY:20723171..20723171
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8727_F GCAGGGAACATCAGACACTG
Reverse Primer: FGC8727_R TTCTCCTCTGGCTTTGCTTG
Reviews

Customers who bought this product also purchased
FGC8733
FGC8733
FGC8728
FGC8728
FGC8716
FGC8716
FGC8715
FGC8715
FGC8729
FGC8729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies