Top » Catalog » J1 » FGC14706

$18.00

FGC14706
[FGC14706]

FGC14706
hg38 Position: ChrY:12790744..12790744
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC14706_F GACAGTTCTGGGATCTTGAATG
Reverse Primer: FGC14706_R GCCAGACCCAAAAGAGTACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK597
1 x A13636
1 x A24499
1 x FGC10411
$72.00
Haplogroup Info
Other products
Currencies