Top » Catalog » J1 » FGC14710

$18.00

FGC14710
[FGC14710]

FGC14710
hg38 Position: ChrY:9030684..9030685
Ancestral: del
Derived: ins
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: Downdtream FGC7393
Forward Primer: FGC14710_F GTATTTCAAAGTAAATTGAAGACACCTATG
Reverse Primer: FGC14710_R GAAGACAAACTTGTGAAGCGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
$396.00
Haplogroup Info
Other products
Currencies