Top » Catalog » J1 » FGC14710

$18.00

FGC14710
[FGC14710]

FGC14710
hg38 Position: ChrY:9030684..9030685
Ancestral: del
Derived: ins
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: Downdtream FGC7393
Forward Primer: FGC14710_F GTATTTCAAAGTAAATTGAAGACACCTATG
Reverse Primer: FGC14710_R GAAGACAAACTTGTGAAGCGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41723
$18.00
Haplogroup Info
Other products
Currencies