Top » Catalog » J1 » FGC14712

$18.00

FGC14712
[FGC14712]

FGC14712
hg38 Position: ChrY:18969878..18969885
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC14712_F TTTCTGTTCCATTTTGATCAGTG
Reverse Primer: FGC14712_R AGCAGTGACATGAGAACGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38648
1 x A20304
1 x FGC4720
1 x A13635
1 x FGC13864
1 x FGC4358
1 x FGC14446
1 x FGC4356
1 x A15552
$162.00
Haplogroup Info
Other products
Currencies