Top » Catalog » J1 » FGC22746

$18.00

FGC22746
[FGC22746]

FGC22746
hg38 Position: ChrY:8844932..8844932
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22746_F TCACACTGTTGGTGGGAATC
Reverse Primer: FGC22746_R CTGTGTGCCCACATGTTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies