Top » Catalog » J1 » FGC22751

$18.00

FGC22751
[FGC22751]

FGC22751
hg38 Position: ChrY:14400240..14400245
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC22751_F ACTCGGAAAACCATGTCTGC
Reverse Primer: FGC22751_R GCAGAGGTTGCAGTGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
1 x BY37872
1 x A13647
$180.00
Haplogroup Info
Other products
Currencies