Top » Catalog » J1 » FGC54257

$18.00

FGC54257
[FGC54257]

FGC54257
hg38 Position: ChrY:8012778..8012778
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54257_F ATTGTACCTCTGCACTCCAGACTG
Reverse Primer: FGC54257_R GGGAGATTGTGAATCTCATATACATACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC19465
$18.00
Haplogroup Info
Other products
Currencies