Top » Catalog » J1 » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Note: 99.1% X, no warranty
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
FGC34530
FGC34530
ZS5814
ZS5814
ZS5801
ZS5801
ZS11617
ZS11617
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK620
1 x FGC42794
1 x FGC29863
1 x FGC20864
1 x FGC7982
1 x FGC12858
1 x ALK6
1 x FGC4423
1 x ALK365
1 x FGC19503
$180.00
Haplogroup Info
Other products
Currencies