Top » Catalog » J1 » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Note: 99.1% X, no warranty
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
FGC4314
FGC4314
FGC48132
FGC48132
FGC7936
FGC7936
ZS8266
ZS8266
FGC4316
FGC4316
ZS11060
ZS11060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies