Top » Catalog » J1 » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Note: 99.1% X, no warranty
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
A19335
A19335
ZS11617
ZS11617
FGC34530
FGC34530
ZS11666
ZS11666
ZS5814
ZS5814
ZS11817
ZS11817
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY155375
$18.00
Haplogroup Info
Other products
Currencies