Top » Catalog » J1 » BY145

$18.00

BY145
[BY145]

BY145
hg38 Position: ChrY:11713650..11713650
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
ZS8260
ZS8260
ZS7095
ZS7095
Y36224
Y36224
ZS7531
ZS7531
P58
P58
ZS12329
ZS12329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies