Top » Catalog » J1 » FGC58370

$18.00

FGC58370
[FGC58370]

FGC58370
hg38 Position: ChrY:12561666..12561666
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58370_F GGATATGGAAGCATATTTAGAGTCAGC
Reverse Primer: FGC58370_R ACAAGAGCTGGGACCGCACCCTGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies