Top » Catalog » J1 » BY4145

$18.00

BY4145
[BY4145]

BY4145
hg38 Position: ChrY:23459881..23459881
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: J1
Comments: Palindromic but single copy in J1?
Forward Primer: BY4145_F TCTAACCTGCTTGGTGTTTCCA
Reverse Primer: BY4145_R CCTGCCTCAGCCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19335
$18.00
Haplogroup Info
Other products
Currencies