Top » Catalog » J1 » FGC42459

$18.00

FGC42459
[FGC42459]

FGC42459
hg38 Position: ChrY:22238036..22238039
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42459_F CTGTATTCACAAAAAATTAAAAATAAAAAAC
Reverse Primer: FGC42459_R CAGAAATGAGTTTTCTGGACGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
1 x BY37872
1 x A13647
1 x FGC4357
1 x FGC19205
1 x FGC4348
1 x FGC8733
1 x A24906
1 x A23662
1 x A13640
1 x BY136
1 x A16981
$342.00
Haplogroup Info
Other products
Currencies