Top » Catalog » J1 » FGC42459

$18.00

FGC42459
[FGC42459]

FGC42459
hg38 Position: ChrY:22238036..22238039
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42459_F CTGTATTCACAAAAAATTAAAAATAAAAAAC
Reverse Primer: FGC42459_R CAGAAATGAGTTTTCTGGACGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4430
1 x A13633
1 x FGC4245
1 x A23886
1 x FGC47843
$90.00
Haplogroup Info
Other products
Currencies