Top » Catalog » J1 » FGC40449

$18.00

FGC40449
[FGC40449]

FGC40449
hg38 Position: ChrY:12355206..12355206
Ancestral: G
Derived: T
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1
Comments: Below FGC8810
Forward Primer: FGC40449_F GGACAAGGTGAAGGCTGGTC
Reverse Primer: FGC40449_R TCATACCCCGAGCTCTCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4285
1 x FGC42837
1 x FGC4421
1 x A23687
1 x A16979
1 x BY200880
1 x FGC30570
1 x ALK367
1 x BY38105
1 x FGC39468
$180.00
Haplogroup Info
Other products
Currencies