Top » Catalog » J1 » A16981

$18.00

A16981
[A16981]

A16981
hg38 Position: ChrY:19661672..19661672
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: J1
Comments: ZS5809 > ZS11614
Forward Primer: A16981_F GAAAAGACCAGACCTATGTTTGG
Reverse Primer: A16981_R GTTTTCTTTTAGGATTTTTATGGTTGTAC
Reviews

Customers who bought this product also purchased
A16982
A16982
A16980
A16980
A16979
A16979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies