Top » Catalog » J1 » A16980

$18.00

A16980
[A16980]

A16980
hg38 Position: ChrY:15295235..15295235
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: J1
Comments: ZS5809 > ZS11614
Forward Primer: A16980_F GGGGCTTTATAATATATAGTATTATTATAGTGACC
Reverse Primer: A16980_R CATACTTTACATATACTATCTAGAGTATATCCACAG
Reviews

Customers who bought this product also purchased
A16979
A16979
A16982
A16982
A16981
A16981
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies