Top » Catalog » J1 » FGC12857

$18.00

FGC12857
[FGC12857]

FGC12857
hg38 Position: ChrY:8099728..8099728
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC12857_F CTAGTTTTGAATGGGTTTGCG
Reverse Primer: FGC12857_R CCCACTGTCAACATTAACCAGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies