Top » Catalog » J1 » FGC12862

$18.00

FGC12862
[FGC12862]

FGC12862
hg38 Position: ChrY:14117644..14117644
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC12862_F TGTCTCCGCTTCTACCACAG
Reverse Primer: FGC12862_R TGAGGGTAGGAGCCAATAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41745
1 x FGC4429
1 x FGC37526
1 x FGC29983
1 x BY81893
1 x FGC16658
1 x A17827
1 x A19271
1 x FGC5237
1 x FGC5488
1 x FGC42835
1 x FGC20860
1 x FGC4712
1 x A14885
1 x FGC12832
1 x FGC48132
1 x BY40741
1 x FGC5424
1 x BY68843
$342.00
Haplogroup Info
Other products
Currencies