Top » Catalog » J1 » FGC12862

$18.00

FGC12862
[FGC12862]

FGC12862
hg38 Position: ChrY:14117644..14117644
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC12862_F TGTCTCCGCTTCTACCACAG
Reverse Primer: FGC12862_R TGAGGGTAGGAGCCAATAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4244
$18.00
Haplogroup Info
Other products
Currencies