Top » Catalog » J1 » FGC29982

$18.00

FGC29982
[FGC29982]

FGC29982
hg38 Position: ChrY:15412833..15412833
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4243
Forward Primer: FGC29982_F ACTGTGCTGTCACTGGTTCAC
Reverse Primer: FGC29982_R CCTTAGACCAATTCCCAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies