Top » Catalog » J1 » FGC29983

$18.00

FGC29983
[FGC29983]

FGC29983
hg38 Position: ChrY:17178840..17178840
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4243
Forward Primer: FGC29983_F CCCAATACACACAGGCACAC
Reverse Primer: FGC29983_R AGAGCAGCCTCAAGTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies