Top » Catalog » J1 » FGC30612

$18.00

FGC30612
[FGC30612]

FGC30612
hg38 Position: ChrY:15395219..15395219
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC10030
Forward Primer: FGC30612_F GCAGGTCTATCAGCCTGTCC
Reverse Primer: FGC30612_R TGCTGACCCTTTTTCCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies