Top » Catalog » J1 » FGC30612

$18.00

FGC30612
[FGC30612]

FGC30612
hg38 Position: ChrY:15395219..15395219
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC10030
Forward Primer: FGC30612_F GCAGGTCTATCAGCCTGTCC
Reverse Primer: FGC30612_R TGCTGACCCTTTTTCCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40447
1 x FGC12857
1 x FGC37843
1 x BY32851
1 x ALK161
1 x ALK281
1 x FGC4417
1 x FGC4402
1 x A18931
1 x FGC4339
1 x A16982
1 x FGC40060
$216.00
Haplogroup Info
Other products
Currencies