Top » Catalog » J1 » A17373

$18.00

A17373
[A17373]

A17373
hg38 Position: ChrY:13577466..13577466
Ancestral: C
Derived: A
Reference: David Sterner (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A17373_F AATTTTGTGCAGCAAACCAC
Reverse Primer: A17373_R GGGATTCTTGGATCAAATGG
Reviews

Customers who bought this product also purchased
A17372
A17372
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies