Top » Catalog » J1 » A17373

$18.00

A17373
[A17373]

A17373
hg38 Position: ChrY:13577466..13577466
Ancestral: C
Derived: A
Reference: David Sterner (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A17373_F AATTTTGTGCAGCAAACCAC
Reverse Primer: A17373_R GGGATTCTTGGATCAAATGG
Reviews

Customers who bought this product also purchased
A17372
A17372
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies