Top » Catalog » J1 » FGC11759

$18.00

FGC11759
[FGC11759]

FGC11759
hg38 Position: ChrY:21137548..21137548
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: .
Forward Primer: FGC11759_F GATTTGTCCCAACTAACACTTAAGTG
Reverse Primer: FGC11759_R GTGGCTCACACTTGTAATCCC
Reviews

Customers who bought this product also purchased
FGC11743
FGC11743
ZS4753
ZS4753
FGC1
FGC1
FGC2
FGC2
FGC1696
FGC1696
FGC4316
FGC4316
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies