Top » Catalog » J1 » FGC30610

$18.00

FGC30610
[FGC30610]

FGC30610
hg38 Position: ChrY:7215271..7215271
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC30611
Forward Primer: FGC30610_F TTCCAGCTACTCAGGAGGCTAG
Reverse Primer: FGC30610_R CATAGTTGTCAAGAGATATCCCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK597
1 x A13636
1 x A24499
1 x FGC10411
1 x A19334
1 x FGC14712
1 x FGC19188
1 x ALK3
1 x FGC15940
1 x FGC5231
1 x FGC42789
1 x FGC12860
1 x FGC31164
1 x ALK115
1 x ALK908
1 x FGC22746
1 x FGC29978
1 x FGC4245
1 x A21956
$342.00
Haplogroup Info
Other products
Currencies