Top » Catalog » J1 » FGC30610

$18.00

FGC30610
[FGC30610]

FGC30610
hg38 Position: ChrY:7215271..7215271
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC30611
Forward Primer: FGC30610_F TTCCAGCTACTCAGGAGGCTAG
Reverse Primer: FGC30610_R CATAGTTGTCAAGAGATATCCCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies