Top » Catalog » J1 » A17826

$18.00

A17826
[A17826]

A17826
hg38 Position: ChrY:13800329..13800329
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17826_F ACCTGGATTTGGTCTGTTGC
Reverse Primer: A17826_R GTGGCTCATGCCTGTAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies