Top » Catalog » J1 » A17826

$18.00

A17826
[A17826]

A17826
hg38 Position: ChrY:13800329..13800329
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17826_F ACCTGGATTTGGTCTGTTGC
Reverse Primer: A17826_R GTGGCTCATGCCTGTAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
$180.00
Haplogroup Info
Other products
Currencies