Top » Catalog » J1 » A17827

$18.00

A17827
[A17827]

A17827
hg38 Position: ChrY:17287823..17287823
Ancestral: G
Derived: T
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17827_F GACAGAACCAGAGAACTATTTGAGC
Reverse Primer: A17827_R AACTTGTTTGTGGTGGTCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies