Top » Catalog » J1 » A17829

$18.00

A17829
[A17829]

A17829
hg38 Position: ChrY:19369751..19369751
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17829_F TCTTGCCTGATTGGTCTGAG
Reverse Primer: A17829_R TGGAAATAAGATTCAAACATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies