Top » Catalog » J1 » A17829

$18.00

A17829
[A17829]

A17829
hg38 Position: ChrY:19369751..19369751
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17829_F TCTTGCCTGATTGGTCTGAG
Reverse Primer: A17829_R TGGAAATAAGATTCAAACATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
1 x FGC29872
1 x BY13781
1 x A22922
1 x ALK534
1 x ALK870
1 x FGC50913
1 x FGC4347
$270.00
Haplogroup Info
Other products
Currencies