Top » Catalog » J1 » A17832

$18.00

A17832
[A17832]

A17832
hg38 Position: ChrY:13467989..13467989
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A17832_F AGTGACTGCTACATAGCAAAGTCAGAC
Reverse Primer: A17832_R CTTTATTTTAGCAGGTGACTTTTACTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies